Stem-loop sequence oar-mir-30b

AccessionMI0025278 (change log)
DescriptionOvis aries miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

2 open access papers mention oar-mir-30b
(4 sentences)

Stem-loop
   -      uuc     cau          u  -a        ua  ac 
5'  ccaagu   caguu   guaaacaucc ac  cucagcug  ac  u
    ||||||   |||||   |||||||||| ||  ||||||||  ||   
3'  gguuca   gucga   cauuuguagg ug  gggucggc  ug  u
   a      ---     cuu          -  ga        --  ag 
Get sequence
Deep sequencing
115283 reads, 2.42e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr9: 19941548-19941635 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-30b
oar-mir-30dchr9: 19937109-19937178 [+]
oar-mir-30bchr9: 19941548-19941635 [+]
Database links

Mature sequence oar-miR-30b

Accession MIMAT0030057
Sequence

17 - 

uguaaacauccuacacucagc

 - 37

Get sequence
Deep sequencing115193 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).