Stem-loop sequence oar-mir-30a

AccessionMI0025277 (change log)
DescriptionOvis aries miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

5 open access papers mention oar-mir-30a
(10 sentences)

Stem-loop
   ----            uc           ---g  ag 
5'     cuguaaacaucc  gacuggaagcu    ug  g
       ||||||||||||  |||||||||||    ||   
3'     gacguuuguagg  cugacuuucgg    ac  c
   cguc            --           aaag  gu 
Get sequence
Deep sequencing
213683 reads, 4.31e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr9: 2731890-2731956 [+]
intergenic
Database links

Mature sequence oar-miR-30a-5p

Accession MIMAT0030055
Sequence

2 - 

uguaaacauccucgacuggaagc

 - 24

Get sequence
Deep sequencing212285 reads, 13 experiments
Evidence experimental; cloned [1]

Mature sequence oar-miR-30a-3p

Accession MIMAT0030056
Sequence

43 - 

cuuucagucggauguuugcag

 - 63

Get sequence
Deep sequencing1393 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).