Stem-loop sequence oar-mir-26b

AccessionMI0025274 (change log)
DescriptionOvis aries miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

7 open access papers mention oar-mir-26b
(14 sentences)

Stem-loop
   -u  -    ga   -   u        uc           u ug 
5'   gc ccgg  ccc agu caaguaau  aggauagguug g  c
     || ||||  ||| ||| ||||||||  ||||||||||| |   
3'   cg ggcc  ggg ucg guucauua  ucuuguccgac c  u
   cc  u    gg   c   -        cc           - ug 
Get sequence
Deep sequencing
267519 reads, 4.38e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr2: 219394286-219394370 [+]
sense
ENSOART00000021298 ; CTDSP1-201; intron 4
Database links

Mature sequence oar-miR-26b

Accession MIMAT0030052
Sequence

15 - 

uucaaguaauucaggauaggu

 - 35

Get sequence
Deep sequencing267402 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).