Stem-loop sequence oar-mir-26a

AccessionMI0025273 (change log)
DescriptionOvis aries miR-26a stem-loop
Gene family MIPF0000043; mir-26
Literature search

8 open access papers mention oar-mir-26a
(31 sentences)

Stem-loop
         gg ug  uu         c          guuucc 
5' ggcugu  c  ga  caaguaauc aggauaggcu      a
   ||||||  |  ||  ||||||||| ||||||||||       
3' ucgacg  g  cu  guucauuag ucuuauccgg      u
         ga gu  uu         u          agugcc 
Get sequence
Deep sequencing
310105 reads, 5.06e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr3: 161359064-161359147 [+]
sense
ENSOART00000005270 ; CTDSP2-201; intron 5
Database links

Mature sequence oar-miR-26a

Accession MIMAT0030051
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing310045 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).