Stem-loop sequence oar-mir-23a

AccessionMI0025270 (change log)
DescriptionOvis aries miR-23a stem-loop
Gene family MIPF0000027; mir-23
Literature search

4 open access papers mention oar-mir-23a
(5 sentences)

Stem-loop
     c   c     -       g    g      c  c 
5' gg cgg ugggg uuccugg gaug gauuug ug c
   || ||| ||||| ||||||| |||| |||||| || u
3' cc gcc accuu agggacc uuac cuaaac ac g
     a   a     u       g    a      -  u 
Get sequence
Deep sequencing
406178 reads, 7.02e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr5: 9882124-9882196 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-23a
oar-mir-23achr5: 9882124-9882196 [+]
oar-mir-27achr5: 9882298-9882375 [+]
Database links

Mature sequence oar-miR-23a

Accession MIMAT0030048
Sequence

45 - 

aucacauugccagggauuucca

 - 66

Get sequence
Deep sequencing406169 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).