Stem-loop sequence oar-mir-22

AccessionMI0025268 (change log)
DescriptionOvis aries miR-22 stem-loop
Gene family MIPF0000053; mir-22
Literature search

5 open access papers mention oar-mir-22
(30 sentences)

Stem-loop
      u   cc               -     a      u  ccu 
5' ggc gag  gcaguaguucuucag uggca gcuuua gu   g
   ||| |||  ||||||||||||||| ||||| |||||| ||   a
3' ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
      u   -c               g     -      -  acc 
Get sequence
Deep sequencing
36529 reads, 6.45e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr11: 22392931-22393015 [-]
sense
ENSOART00000025049 ; oar-mir-22-201; exon 1
Database links

Mature sequence oar-miR-22-3p

Accession MIMAT0030046
Sequence

53 - 

aagcugccaguugaagaacug

 - 73

Get sequence
Deep sequencing33876 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).