Stem-loop sequence oar-mir-218a

AccessionMI0025267 (change log)
DescriptionOvis aries miR-218a stem-loop
Gene family MIPF0000026; mir-218
Literature search

2 open access papers mention oar-mir-218a
(2 sentences)

Stem-loop
   uuu         cu        gguggaacga  g 
5'    gugcuugau  aaccaugu          ug a
      |||||||||  ||||||||          ||  
3'    cacgaacug  uugguaca          gc a
   --c         uc        --------ag  a 
Get sequence
Deep sequencing
2945 reads, 477 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr16: 577231-577292 [-]
sense
ENSOART00000024350 ; oar-mir-218a-201; exon 1
ENSOART00000003034 ; SLIT3-201; intron 9
Database links

Mature sequence oar-miR-218a

Accession MIMAT0030045
Sequence

2 - 

uugugcuugaucuaaccaugu

 - 22

Get sequence
Deep sequencing2919 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).