Stem-loop sequence oar-mir-200c

AccessionMI0025266 (change log)
DescriptionOvis aries miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

5 open access papers mention oar-mir-200c
(6 sentences)

Stem-loop
   ----    -      a        u   u   gg 
5'     cguc uuaccc gcaguguu ggg gcu  u
       |||| |||||| |||||||| ||| |||  u
3'     guag aauggg cgucauaa cuc uga  g
   ggag    u      c        u   -   gg 
Get sequence
Deep sequencing
14940 reads, 3.98e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr3: 207226030-207226094 [-]
sense
ENSOART00000023866 ; oar-mir-200c-201; exon 1
Database links

Mature sequence oar-miR-200c

Accession MIMAT0030044
Sequence

41 - 

uaauacugccggguaaugaugg

 - 62

Get sequence
Deep sequencing14918 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).