Stem-loop sequence oar-mir-19b

AccessionMI0025263 (change log)
DescriptionOvis aries miR-19b stem-loop
Gene family MIPF0000011; mir-19
Literature search

5 open access papers mention oar-mir-19b
(16 sentences)

Stem-loop
        uu                 -  -      uc    ugugu 
5' cacug  cuaugguuaguuuugca gg uuugca  cagc     g
   |||||  ||||||||||||||||| || ||||||  ||||     a
3' gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
        --                 a  u      --    ucuua 
Get sequence
Deep sequencing
708014 reads, 1.42e+05 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr10: 66142232-66142318 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-19b
oar-mir-17chr10: 66141653-66141736 [+]
oar-mir-19bchr10: 66142232-66142318 [+]
Database links

Mature sequence oar-miR-19b

Accession MIMAT0030041
Sequence

54 - 

ugugcaaauccaugcaaaacuga

 - 76

Get sequence
Deep sequencing706947 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).