Stem-loop sequence oar-mir-199a

AccessionMI0025262 (change log)
DescriptionOvis aries miR-199a stem-loop
Gene family MIPF0000040; mir-199
Literature search

5 open access papers mention oar-mir-199a
(23 sentences)

Stem-loop
   uggaagcuucuggagau   -    c   gcc       u        c   --uca  ac 
5'                  ccu gcuc guc   ccagugu cagacuac ugu     gg  a
                    ||| |||| |||   ||||||| |||||||| |||     ||   
3'                  gga cggg cag   gguuaca gucugaug aca     cc  a
   ----------------g   a    u   auu       c        -   uguug  gu 
Get sequence
Deep sequencing
88321 reads, 1.41e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr12: 37693649-37693752 [-]
intergenic
Database links

Mature sequence oar-miR-199a-3p

Accession MIMAT0030040
Sequence

70 - 

acaguagucugcacauugguu

 - 90

Get sequence
Deep sequencing70796 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).