Stem-loop sequence oar-mir-181a-2

AccessionMI0025259 (change log)
DescriptionOvis aries miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention oar-mir-181a-2
(8 sentences)

Stem-loop
   ugccagggcaggauccagucuuca     cu      a   u      cu       a    ggga 
5'                         gagga  ccaagg aca ucaacg  gucggug guuu    u
                           |||||  |||||| ||| ||||||  ||||||| ||||    u
3'                         uuccu  gguucc ugu aguugc  cagccac caaa    u
   -----------------------a     ug      a   c      --       -    aaag 
Get sequence
Deep sequencing
52134 reads, 7.85e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr3: 11056201-11056309 [-]
intergenic
Database links

Mature sequence oar-miR-181a

Accession MIMAT0014973
Sequence

38 - 

aacauucaacgcugucggugagu

 - 60

Get sequence
Deep sequencing103330 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).