Stem-loop sequence oar-mir-17

AccessionMI0025258 (change log)
DescriptionOvis aries miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

3 open access papers mention oar-mir-17
(4 sentences)

Stem-loop
       ga       -ca        a  g     g   -  au 
5' guca  auaaugu   aagugcuu ca ugcag uag ug  u
   ||||  |||||||   |||||||| || ||||| ||| ||  u
3' cagu  uauuacg   uucacgga gu acguc auc ac  g
       gg       aug        a  g     -   u  gu 
Get sequence
Deep sequencing
60748 reads, 1.11e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr10: 66141653-66141736 [+]
intergenic
Clustered miRNAs
< 10kb from oar-mir-17
oar-mir-17chr10: 66141653-66141736 [+]
oar-mir-19bchr10: 66142232-66142318 [+]
Database links

Mature sequence oar-miR-17-5p

Accession MIMAT0030037
Sequence

14 - 

caaagugcuuacagugcaggua

 - 35

Get sequence
Deep sequencing56594 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).