Stem-loop sequence oar-mir-16b

AccessionMI0025257 (change log)
DescriptionOvis aries miR-16b stem-loop
Gene family MIPF0000006; mir-15
Literature search

4 open access papers mention oar-mir-16b
(10 sentences)

Stem-loop
   caua     uc    cu         ua        --gg     aa 
5'     cuugu  cgcu  agcagcacg  aauauugg    uagua  a
       |||||  ||||  |||||||||  ||||||||    |||||  u
3'     ggaca  gcga  ucgucgugu  uuauaacc    auuau  a
   --ag     gu    uu         ua        acaa     aa 
Get sequence
Deep sequencing
371577 reads, 7.59e+04 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr1: 224971191-224971283 [-]
sense
ENSOART00000002211 ; SMC4-201; intron 5
Database links

Mature sequence oar-miR-16b

Accession MIMAT0030036
Sequence

17 - 

uagcagcacguaaauauugg

 - 36

Get sequence
Deep sequencing370630 reads, 14 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).