Stem-loop sequence oar-mir-152

AccessionMI0025256 (change log)
DescriptionOvis aries miR-152 stem-loop
Gene family MIPF0000056; mir-148
Literature search

1 open access papers mention oar-mir-152
(3 sentences)

Stem-loop
   ----------       u      g  a u  cc    cgg   c 
5'           ggcccag uucugu au c cu  gacu   gcu u
             ||||||| |||||| || | ||  ||||   |||  
3'           ccggguu aagaca ua g ga  cuga   cga g
   ccaggcaggc       c      g  c u  --    ---   g 
Get sequence
Deep sequencing
23600 reads, 4.16e+03 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence oar-miR-152

Accession MIMAT0030035
Sequence

44 - 

ucagugcaugacagaacuugg

 - 64

Get sequence
Deep sequencing23598 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).