Stem-loop sequence oar-mir-150

AccessionMI0025255 (change log)
DescriptionOvis aries miR-150 stem-loop
Gene family MIPF0000197; mir-150
Literature search

3 open access papers mention oar-mir-150
(5 sentences)

Stem-loop
   ------ucuc      c  -           aacc          u ug gu 
5'           uccuca gg cccugucuccc    cuuguaccag g  u  c
             |||||| || |||||||||||    |||||||||| |  |   
3'           aggggu cc gggacggaggg    ggacaugguc c  g  u
   cgacgacccu      -  a           gcau          - cu gc 
Get sequence
Deep sequencing
14531 reads, 2.38e+03 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr14: 54868231-54868327 [-]
intergenic
Database links

Mature sequence oar-miR-150

Accession MIMAT0030034
Sequence

19 - 

ucucccaacccuuguaccagug

 - 40

Get sequence
Deep sequencing14488 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).