Stem-loop sequence oar-mir-148a

AccessionMI0025254 (change log)
DescriptionOvis aries miR-148a stem-loop
Gene family MIPF0000056; mir-148
Literature search

7 open access papers mention oar-mir-148a
(15 sentences)

Stem-loop
                 -  -a    cc    -   aa 
5' gaggcaaaguucug ag  cacu  gacu cug  u
   |||||||||||||| ||  ||||  |||| |||  a
3' cucuguuucaagac uc  guga  cuga gau  u
                 a  ac    --    a   ag 
Get sequence
Deep sequencing
58641 reads, 1.62e+04 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr4: 69902133-69902200 [+]
intergenic
Database links

Mature sequence oar-miR-148a

Accession MIMAT0030033
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing58292 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).