Stem-loop sequence oar-mir-143

AccessionMI0025253 (change log)
DescriptionOvis aries miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

12 open access papers mention oar-mir-143
(41 sentences)

Stem-loop
   ------gcguccug      ag      g         g      u  -  ag 
5'               ucuccc  ccugag ugcagugcu caucuc gg uc  u
                 ||||||  |||||| ||||||||| |||||| || ||   
3'               agaggg  gggcuc augucacga guagag cu ag  u
   cgacaucuuguuga      aa      g         a      u  g  gg 
Get sequence
Deep sequencing
365177 reads, 6.48e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr5: 58248543-58248643 [+]
intergenic
Database links

Mature sequence oar-miR-143

Accession MIMAT0030032
Sequence

56 - 

ugagaugaagcacuguagcuc

 - 76

Get sequence
Deep sequencing363348 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).