Stem-loop sequence oar-mir-10b

AccessionMI0025252 (change log)
DescriptionOvis aries miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

7 open access papers mention oar-mir-10b
(13 sentences)

Stem-loop
   -caguaa     u        a    g     c          u g   c 
5'        cguug cuauauau cccu uagaa cgaauuugug g uau c
          ||||| |||||||| |||| ||||| |||||||||| | |||  
3'        guagc gguauaua gggg aucuu gcuuagacac u aug a
   caaaaac     u        a    -     a          - g   u 
Get sequence
Deep sequencing
135490 reads, 2.56e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr2: 132868982-132869080 [-]
intergenic
Database links

Mature sequence oar-miR-10b

Accession MIMAT0030031
Sequence

21 - 

acccuguagaaccgaauuugug

 - 42

Get sequence
Deep sequencing134762 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).