Stem-loop sequence oar-mir-107

AccessionMI0025250 (change log)
DescriptionOvis aries miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

1 open access papers mention oar-mir-107
(1 sentences)

Stem-loop
   c   c      --c    u  u           c   u   a 
5'  ucu ugcuuu   agcu cu uacaguguugc uug ggc u
    ||| ||||||   |||| || ||||||||||| ||| ||| g
3'  aga acgaaa   ucgg ga auguuacgacg aac uug g
   -   c      cua    -  c           -   -   a 
Get sequence
Deep sequencing
108992 reads, 2.22e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr22: 10962238-10962318 [-]
sense
ENSOART00000026255 ; oar-mir-107-201; exon 1
ENSOART00000016657 ; PANK1-201; intron 5
Database links

Mature sequence oar-miR-107

Accession MIMAT0030029
Sequence

50 - 

agcagcauuguacagggcuauc

 - 71

Get sequence
Deep sequencing108662 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).