Stem-loop sequence oar-mir-103

AccessionMI0025248 (change log)
DescriptionOvis aries miR-103 stem-loop
Gene family MIPF0000024; mir-103
Literature search

6 open access papers mention oar-mir-103
(14 sentences)

Stem-loop
   cu   c  --    u  c           c   -  g   
5'   gcc uc  ggcu cu uacagugcugc uug uc ca 
     ||| ||  |||| || ||||||||||| ||| || | u
3'   cgg ag  ucgg ga auguuacgacg aac ag gg 
   --   a  ua    -  c           -   u  g   
Get sequence
Deep sequencing
109509 reads, 2.23e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr16: 335467-335538 [-]
sense
ENSOART00000002958 ; PANK3-201; intron 5
Database links

Mature sequence oar-miR-103

Accession MIMAT0030027
Sequence

46 - 

agcagcauuguacagggcuaug

 - 67

Get sequence
Deep sequencing109267 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).