Stem-loop sequence oar-let-7f

AccessionMI0025245 (change log)
DescriptionOvis aries let-7f stem-loop
Gene family MIPF0000002; let-7
Literature search

16 open access papers mention oar-let-7f
(42 sentences)

Stem-loop
   u      u   gu                uuagggucauac 
5'  guggga gag  aguagauuguauaguu            c
    |||||| |||  ||||||||||||||||             
3'  cacccu uuc  ucaucugacauaucaa            c
   g      -   ug                uagagguucuac 
Get sequence
Deep sequencing
390985 reads, 8.54e+04 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chrX: 49406222-49406304 [+]
sense
ENSOART00000008490 ; HUWE1-202; intron 59
ENSOART00000008481 ; HUWE1-201; intron 60
Database links

Mature sequence oar-let-7f

Accession MIMAT0030024
Sequence

8 - 

ugagguaguagauuguauagu

 - 28

Get sequence
Deep sequencing389708 reads, 16 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).