Stem-loop sequence mtr-MIR2592br

AccessionMI0025236 (change log)
DescriptionMedicago truncatula miR2592br stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592br
(2 sentences)

Stem-loop
               c        u                g                 u         a  u      -c       g  - g         a     -          -      a 
5' aauucaaacuug caaacgac aggacucaaguauuuc cucggcauucauguuuu ccuuugaaa ga uaaauu  uuguuag cu g uuuagauga gguau uaagugucaa ggaaug a
   |||||||||||| |||||||| |||||||||||||||| ||||||||||||||||| ||||||||| || ||||||  ||||||| || | ||||||||| ||||| |||||||||| |||||| c
3' uuaaguuugaac guuuguug uccugaguucguaaag gggccguaaguacaaaa ggaaacuuu cu auuuaa  aauaauu ga c aaaucuacu ccaua guucacgguu cuuuac c
               a        -                g                 -         -  u      aa       g  a g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 15307805-15308050 [+]
intergenic
Database links

Mature sequence mtr-miR2592br-5p

Accession MIMAT0030013
Sequence

19 - 

gacuaggacucaaguauuucg

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2592br-3p

Accession MIMAT0030014
Sequence

211 - 

aaaugcuugaguccuguuguu

 - 231

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).