Stem-loop sequence mtr-MIR2592bq

AccessionMI0025235 (change log)
DescriptionMedicago truncatula miR2592bq stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bq
(2 sentences)

Stem-loop
       c     u          c              aa    a        a     c         gau      c      u   - g         a     -              -  a 
5' aauu aaacu gccaaacgac augacucaaguauu  gccc gcguucau uuuuu cuuugaaaa   uaaauu uuguua gcu g uuuagauga gguau uaagugucaaugaa ug a
   |||| ||||| |||||||||| ||||||||||||||  |||| |||||||| ||||| |||||||||   |||||| |||||| ||| | ||||||||| ||||| |||||||||||||| || c
3' uuaa uuuga cgguuuguug uacugaguucguaa  cggg cgcaagua aaaaa gaaacuuuu   auuuaa aacaau cga c aaaucuacu ccaua guucacgguugcuu ac c
       a     c          -              ag    g        c     a         auu      a      c   a g         a     a              u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 3215835-3216081 [+]
intergenic
Database links

Mature sequence mtr-miR2592bq-5p

Accession MIMAT0030011
Sequence

18 - 

cgaccaugacucaaguauuaa

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2592bq-3p

Accession MIMAT0030012
Sequence

212 - 

aaaugcuugagucauguuguu

 - 232

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).