Stem-loop sequence mtr-MIR2592bp

AccessionMI0025234 (change log)
DescriptionMedicago truncatula miR2592bp stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bp
(2 sentences)

Stem-loop
   aauau   -    -acaa      u    c            c          u              uaaca              u     a  aa     gguauaaacgu 
5'      gag uguu     aaugcu gagu cuguuguuuggc aguuugaauu accccauucagagg     aauuguuguaguug aaggu ca  cguuc           c
        ||| ||||     |||||| |||| |||||||||||| |||||||||| ||||||||||||||     |||||||||||||| ||||| ||  |||||            
3'      uuc acga     uuacga cuca gacggcaaauug ucaaacuuaa ugggguaaguuucc     uuaacaacgucaac uucca gu  guaag           c
   --aag   u    guagc      c    a            u          -              uucug              c     c  aa     gaacuagaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 934556-934780 [+]
intergenic
Database links

Mature sequence mtr-miR2592bp-5p

Accession MIMAT0030009
Sequence

16 - 

aaaugcuugaguccuguuguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2592bp-3p

Accession MIMAT0030010
Sequence

192 - 

cggcagaacuccagcauucga

 - 212

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).