Stem-loop sequence mtr-MIR2592bo

AccessionMI0025233 (change log)
DescriptionMedicago truncatula miR2592bo stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bo
(2 sentences)

Stem-loop
               g        c                 au               u          gau      c       u  - g         a     -          -      a 
5' aauucaaacuug caaacggc aggacucaagcauuucg  cggcauucauguuuu ccuuugaaaa   uaaauu uuguuag cu g uuuagauga gguau uaagugucaa ggaaug a
   |||||||||||| |||||||| |||||||||||||||||  ||||||||||||||| ||||||||||   |||||| ||||||| || | ||||||||| ||||| |||||||||| |||||| c
3' uuaaguuugaac guuuguug uccugaguucguaaagc  gcuguaaguacaaaa ggaaacuuuu   auuuaa aacaauc ga c aaaucuacu ccaua guucacgguu cuuuac c
               g        -                 gg               -          auu      a       c  a g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 43332476-43332721 [-]
intergenic
Database links

Mature sequence mtr-miR2592bo-5p

Accession MIMAT0030007
Sequence

18 - 

cggccaggacucaagcauuucg

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2592bo-3p

Accession MIMAT0030008
Sequence

211 - 

aaaugcuugaguccuguuguu

 - 231

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).