Stem-loop sequence mtr-MIR7696d

AccessionMI0025225 (change log)
DescriptionMedicago truncatula miR7696d stem-loop
Gene family MIPF0001669; MIR7696
Literature search

1 open access papers mention mtr-MIR7696d
(2 sentences)

Stem-loop
   u                        c  a     ---ua    a 
5'  gcuucaaguucucauaauucaaaa ga aaguu     ugga g
    |||||||||||||||||||||||| || |||||     |||| u
3'  cgaaguucaagaguauuaaguuuu cu uucaa     acuu u
   a                        u  a     uguaa    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC225474.24: 39292-39379 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR7696d
mtr-MIR7696cAC225474.24: 39293-39378 [+]
mtr-MIR7696aAC225474.24: 39292-39379 [+]
mtr-MIR7696dAC225474.24: 39292-39379 [-]
mtr-MIR7696bAC225474.24: 39289-39381 [-]
mtr-MIR5239AC225474.24: 38945-39055 [-]
Database links

Mature sequence mtr-miR7696d-5p

Accession MIMAT0029992
Sequence

7 - 

aaguucucauaauucaaaacg

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR7696d-3p

Accession MIMAT0029993
Sequence

64 - 

uuuugaauuaugagaacuuga

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).