Stem-loop sequence mtr-MIR7696b

AccessionMI0025223 (change log)
DescriptionMedicago truncatula miR7696b stem-loop
Gene family MIPF0001669; MIR7696
Literature search

1 open access papers mention mtr-MIR7696b
(2 sentences)

Stem-loop
   -ac                         c  a     ---ua    a 
5'    ugcuucaaguucucauaauucaaaa ga aaguu     ugga g
      ||||||||||||||||||||||||| || |||||     |||| u
3'    acgaaguucaagaguauuaaguuuu cu uucaa     acuu u
   cau                         u  a     uguaa    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC225474.24: 39289-39381 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR7696b
mtr-MIR7696cAC225474.24: 39293-39378 [+]
mtr-MIR7696aAC225474.24: 39292-39379 [+]
mtr-MIR7696dAC225474.24: 39292-39379 [-]
mtr-MIR7696bAC225474.24: 39289-39381 [-]
mtr-MIR5239AC225474.24: 38945-39055 [-]
Database links

Mature sequence mtr-miR7696b-5p

Accession MIMAT0029988
Sequence

7 - 

ucaaguucucauaauucaaaa

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR7696b-3p

Accession MIMAT0029989
Sequence

68 - 

uugaauuaugagaacuugaag

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).