Stem-loop sequence mtr-MIR7696a

AccessionMI0025222 (change log)
DescriptionMedicago truncatula miR7696a stem-loop
Gene family MIPF0001669; MIR7696
Literature search

1 open access papers mention mtr-MIR7696a
(2 sentences)

Stem-loop
   u                        a  u     acauuu   a 
5'  gcuucaaguucucauaauucaaaa ga aaguu      gaa a
    |||||||||||||||||||||||| || |||||      |||  
3'  cgaaguucaagaguauuaaguuuu cu uucaa      cuu a
   a                        g  u     --auac   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC225474.24: 39292-39379 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR7696a
mtr-MIR5239AC225474.24: 38945-39055 [-]
mtr-MIR7696bAC225474.24: 39289-39381 [-]
mtr-MIR7696aAC225474.24: 39292-39379 [+]
mtr-MIR7696dAC225474.24: 39292-39379 [-]
mtr-MIR7696cAC225474.24: 39293-39378 [+]
Database links

Mature sequence mtr-miR7696a-5p

Accession MIMAT0029986
Sequence

5 - 

ucaaguucucauaauucaaaa

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR7696a-3p

Accession MIMAT0029987
Sequence

66 - 

uugaauuaugagaacuugaag

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).