Stem-loop sequence osa-MIR7695

AccessionMI0025202 (change log)
DescriptionOryza sativa miR7695 stem-loop
Literature search

5 open access papers mention osa-MIR7695
(19 sentences)

Stem-loop
                       c         a                 ag                 c                                     c     c       a                               c      a                                                   caccacugcgacaaccccuccccucguuccgc 
5' gaguaaaaugcacuagcggu cuuaaacuu ucgggagguuucacuua  uccacgaacuugcaaag gcacaucgaggucucuaaacuugguuuauuguaucau ccggu caaagcc cguuugauuguggucuugccuauguggcacg cacgug augaugacauggaauuuuuuuuauuuuuuucucccuucuuccuucuuuuuu                                c
   |||||||||||||||||||| ||||||||| |||||||||||||||||  ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||                                u
3' cucauuuuauguggucgcca gaauuugaa aguccuccaaagugaau  aggugcuugaacguuuc cguguagcucuagggauuugaaccaaauaauauagua ggcca guuucgg guaaacugacaccagaacggaugcaccgugu gugcac uauuacuguaccuuaaaaaaaauaaaaaaagagggaagaaggaagaaaaaa                                c
                       a         c                 cu                 a                                     a     a       c                               a      c                                                   agagaaagaaggaagaaaaaagagccaccacu 
Get sequence
Deep sequencing
1180 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 11666716-11667202 [-]
intergenic
Database links

Mature sequence osa-miR7695-5p

Accession MIMAT0029961
Sequence

137 - 

ugccuauguggcacgccacgugaa

 - 160

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence osa-miR7695-3p

Accession MIMAT0029962
Sequence

331 - 

acgugaugugccacguaggca

 - 351

Get sequence
Deep sequencing31 reads, 2 experiments
Evidence experimental; 454 [1]

References

1