Stem-loop sequence osa-MIR7693

AccessionMI0025200 (change log)
DescriptionOryza sativa miR7693 stem-loop
Literature search

1 open access papers mention osa-MIR7693
(1 sentences)

Stem-loop
   g                c                           c                       g  a                   a       c                c          ug                     -    agaa 
5'  ggcgaugaggaaucuu uggaagguguggugccacuccggcagu gcagccuccucaacaugggaaug cg caguuggguugaggaggcu gagguuu cgcucuucaucgaugg ugucuguccu  ccuccucggcccucgcugccg auga    c
    |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||  ||||||||||||||||||||| ||||    a
3'  ccgcuacuccuuagaa accuuccacgccacggugaggccguca cgucggaggaguuguacccuuac gc guuaacucaacuccuccga cuccaaa gcgagaaguagcuacc gcaggcagga  ggaggagccgggagcggcggc uauu    a
   -                a                           c                       a  c                   c       a                u          gu                     c    gaag 
Get sequence
Deep sequencing
205 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 25875099-25875419 [-]
intergenic
Database links

Mature sequence osa-miR7693-5p

Accession MIMAT0029957
Sequence

97 - 

guuuccgcucuucaucgauggcug

 - 120

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence osa-miR7693-3p

Accession MIMAT0029958
Sequence

201 - 

gacguccaucgaugaagagcga

 - 222

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; 454 [1]

References

1