Stem-loop sequence bta-mir-7691

AccessionMI0025196 (change log)
DescriptionBos taurus miR-7691 stem-loop
Stem-loop
                  --           accuc 
5' gcugcugagaggucu  aauaacuaaca     u
   |||||||||||||||  |||||||||||     a
3' cgacgacucuccaga  uuauugauugu     c
                  ca           aaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 84195417-84195483 [+]
antisense
ENSBTAT00000018404 ; SSBP2-201; intron 4
Database links

Mature sequence bta-miR-7691

Accession MIMAT0029952
Sequence

4 - 

gcugagaggucuaauaacua

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1