Stem-loop sequence bta-mir-2285z

AccessionMI0025194 (change log)
DescriptionBos taurus miR-2285z stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285z
(15 sentences)

Stem-loop
   uaauuua      -                        cc   cc   c 
5'        aaaugu guuggccagaaaguucauucaggu  uuc  uaa a
          |||||| ||||||||||||||||||||||||  |||  |||  
3'        uuuaca caaccgguuuuucaaguaagucca  aag  auu u
   --guuaa      a                        -a   ac   c 
Get sequence
Deep sequencing
13352 reads, 195 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 13481341-13481436 [+]
antisense
ENSBTAT00000009630 ; SREK1-201; intron 19
Clustered miRNAs
< 10kb from bta-mir-2285z
bta-mir-2285zchr20: 13481341-13481436 [+]
bta-mir-2285qchr20: 13481349-13481431 [-]
Database links

Mature sequence bta-miR-2285z

Accession MIMAT0029950
Sequence

19 - 

ccagaaaguucauucagguccu

 - 40

Get sequence
Deep sequencing51 reads, 26 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1