Stem-loop sequence bta-mir-3613b

AccessionMI0025192 (change log)
DescriptionBos taurus miR-3613b stem-loop
Stem-loop
       gg               cuaaa 
5' guug  cuuuuuuuuuuguuc     a
   ||||  |||||||||||||||     a
3' caac  gaaaaaaaaaacaag     u
       au               caacg 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 19607312-19607366 [+]
antisense
ENSBTAT00000065710 ; bta-mir-3613-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3613b
bta-mir-3613achr12: 19607296-19607381 [-]
bta-mir-3613bchr12: 19607312-19607366 [+]
Database links

Mature sequence bta-miR-3613b

Accession MIMAT0029948
Sequence

35 - 

gaacaaaaaaaaaaguacaac

 - 55

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1