Stem-loop sequence bta-mir-2285x

AccessionMI0025190 (change log)
DescriptionBos taurus miR-2285x stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285x
(15 sentences)

Stem-loop
                      a   ug      g       aaga 
5' uauauuggguuggccaaaa guu  uucagg uuuuucu    u
   ||||||||||||||||||| |||  |||||| |||||||     
3' auauaauccaaccgguuuu caa  aagucu aaaaagg    g
                      -   gu      -       cauu 
Get sequence
Deep sequencing
1184 reads, 8.7 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 61232048-61232133 [+]
intergenic
Database links

Mature sequence bta-miR-2285x

Accession MIMAT0029946
Sequence

51 - 

gaaaaaucugaaugaacuuuugg

 - 73

Get sequence
Deep sequencing1092 reads, 69 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1