Stem-loop sequence bta-mir-2285w

AccessionMI0025189 (change log)
DescriptionBos taurus miR-2285w stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285w
(15 sentences)

Stem-loop
                 -     u      -       c  c  g 
5' uauuggguugacca aaagu cauuca gauuuuc ug aa a
   |||||||||||||| ||||| |||||| ||||||| || ||  
3' auaacccaacuggu uuuca guaagu cuaaaag ac uu u
                 c     u      u       -  a  c 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 29232948-29233030 [+]
intergenic
Database links

Mature sequence bta-miR-2285w

Accession MIMAT0029945
Sequence

11 - 

accaaaaguucauucagauuu

 - 31

Get sequence
Deep sequencing53 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1