Stem-loop sequence bta-mir-2285y

AccessionMI0025188 (change log)
DescriptionBos taurus miR-2285y stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285y
(15 sentences)

Stem-loop
        a    gc      -   c      a   c       u 
5' uguug guug  caaaaa guu guuugg uuu ucuguaa a
   ||||| ||||  |||||| ||| |||||| ||| |||||||  
3' auaac caac  guuuuu caa caaacc aaa aggcauu u
        c    aa      u   a      c   a       c 
Get sequence
Deep sequencing
6670 reads, 25 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 91517938-91518022 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2285y
bta-mir-2285ychr5: 91517938-91518022 [+]
bta-mir-2284z-6chr5: 91517940-91518019 [-]
Database links

Mature sequence bta-miR-2285y

Accession MIMAT0029944
Sequence

52 - 

aaaacccaaacaaacuuuuuu

 - 72

Get sequence
Deep sequencing32 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1