Stem-loop sequence bta-mir-2285af-1

AccessionMI0025186 (change log)
DescriptionBos taurus miR-2285af-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285af-1
(15 sentences)

Stem-loop
        au        -      a c     ca       aca ga 
5' uaugu  uggguugg ccaaaa g uuguu  gguuuuu   u  u
   |||||  |||||||| |||||| | |||||  |||||||   |  g
3' guaca  accuaacc gguuuu c aacaa  ucaaaaa   a  u
        --        a      - a     ac       -gg au 
Get sequence
Deep sequencing
115 reads, 4.65 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 77678684-77678771 [+]
intergenic
Database links

Mature sequence bta-miR-2285af

Accession MIMAT0031057
Sequence

15 - 

gccaaaaagcuuguucagguu

 - 35

Get sequence
Deep sequencing77 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1