Stem-loop sequence bta-mir-2285g-2

AccessionMI0025184 (change log)
DescriptionBos taurus miR-2285g-2 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285g-2
(15 sentences)

Stem-loop
   u  a  -                ug c       auac 
5'  ug gu ggccgaaaaguuuguu  g uuuuucc    c
    || || ||||||||||||||||  | |||||||    a
3'  ac ca ccgguuuuucgaacaa  c aaaaggg    u
   g  c  a                gu c       auuc 
Get sequence
Deep sequencing
1953 reads, 9.46 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 30621132-30621209 [+]
antisense
ENSBTAT00000016895 ; AQR-201; intron 5
Database links

Mature sequence bta-miR-2285g

Accession MIMAT0024582
Sequence

49 - 

aaaccugaacaagcuuuuugg

 - 69

Get sequence
Deep sequencing5359 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1