Stem-loop sequence lva-mir-4854

AccessionMI0025183 (change log)
DescriptionLytechinus variegatus miR-4854 stem-loop
Gene family MIPF0001908; mir-4854
Stem-loop
   -      uu     u   c    g          ----------    u 
5'  ggcgau  ggagc uga gucg cacuguaaca          uggc u
    ||||||  ||||| ||| |||| ||||||||||          ||||  
3'  ccguug  cuucg gcu cagc gugacguugu          acug c
   a      gc     c   u    a          aacaauacuu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-4854-3p

Accession MIMAT0032237
Sequence

56 - 

uguugcagugacgacuucgcgc

 - 77

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).