Stem-loop sequence lva-mir-278

AccessionMI0025165 (change log)
DescriptionLytechinus variegatus miR-278 stem-loop
Gene family MIPF0000155; mir-278
Stem-loop
   ---aaa  a   -     cu g         c      a    gucau    a 
5'       cu ccu cuucu  u gaaugaaag cucgcc aucu     uguu c
         || ||| |||||  | ||||||||| |||||| ||||     ||||  
3'       ga gga gaaga  a cuugcuuuc gggugg ugga     acaa u
   augaua  c   a     uc g         a      c    -----    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-278-3p

Accession MIMAT0032219
Sequence

60 - 

ucggugggacuuucguucgacu

 - 81

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).