Stem-loop sequence lva-mir-210

AccessionMI0025160 (change log)
DescriptionLytechinus variegatus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   cug             a    g        agccauua 
5'    guuaguugcuguc cgcg cacaagag        u
      ||||||||||||| |||| ||||||||         
3'    uagucagcgacag gugc guguucuc        g
   --a             c    -        acauaucu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-210-3p

Accession MIMAT0032214
Sequence

52 - 

uugugcgugcgacagcgacuga

 - 73

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).