Stem-loop sequence lva-mir-96

AccessionMI0025149 (change log)
DescriptionLytechinus variegatus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
           -        u    c       uuuaccucugcug 
5' cuagucug uuuggcac agca auuuugc             a
   |||||||| |||||||| |||| |||||||             g
3' gguuagac gaacugug uugu uagaacg             g
           c        u    a       ugugcuauaacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-96-5p

Accession MIMAT0032203
Sequence

9 - 

uuuggcacuagcacauuuugc

 - 29

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).