Stem-loop sequence lva-mir-71

AccessionMI0025145 (change log)
DescriptionLytechinus variegatus miR-71 stem-loop
Gene family MIPF0000278; mir-71
Stem-loop
   acag   c       c     u        u             ------  a 
5'     gau gguguuc ccggg gaaagaca ggguagugagauu      ug a
       ||| ||||||| ||||| |||||||| |||||||||||||      || u
3'     uua ucauaag ggucc cuuuuugu cuuaucacucuaa      ac u
   -aca   u       c     c        -             caaaac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-71-5p

Accession MIMAT0032200
Sequence

22 - 

ugaaagacauggguagugagauu

 - 44

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).