Stem-loop sequence lva-mir-34

AccessionMI0025144 (change log)
DescriptionLytechinus variegatus miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   ---ugauu    g       uc   ag      u         uuuucc 
5'         ggcu ccuuccu  ggc  uguagu agcugguug      a
           |||| |||||||  |||  |||||| |||||||||      c
3'         cuga ggaagga  ccg  acgucg ucgaccaac      c
   cuaaaguu    -       cc   gg      u         uacuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-34-5p

Accession MIMAT0032199
Sequence

18 - 

ucggcaguguaguuagcugguug

 - 40

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).