Stem-loop sequence lva-mir-33

AccessionMI0025143 (change log)
DescriptionLytechinus variegatus miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   cuu     aag    gg         g          --    uu 
5'    ucuug   ccau  ugcauugua uugcauugca  uguu  u
      |||||   ||||  ||||||||| ||||||||||  ||||  c
3'    agaac   ggua  acgugacau aacgugaugu  acga  u
   --u     gga    aa         a          aa    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-33-5p

Accession MIMAT0032198
Sequence

17 - 

gugcauuguaguugcauugcau

 - 38

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).