Stem-loop sequence lva-mir-31

AccessionMI0025142 (change log)
DescriptionLytechinus variegatus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   -uaua     -     g   a     g   uu          u  gauuu 
5'      aacca gugga aaa ggcaa aug  ggcauagcug gu     a
        ||||| ||||| ||| ||||| |||  |||||||||| ||      
3'      uuggu cacuu uuu ccguu uac  cugugucgac ca     a
   gcuua     g     a   a     a   uc          c  agcau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-31-5p

Accession MIMAT0032197
Sequence

19 - 

aggcaagauguuggcauagcu

 - 39

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).