Stem-loop sequence lva-mir-22

AccessionMI0025139 (change log)
DescriptionLytechinus variegatus miR-22 stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   --------          -u   u       u    aug   a 
5'         acacuucauc  gca gcugaua guua   uug g
           ||||||||||  ||| ||||||| ||||   ||| a
3'         ugugaagugg  cgu cgacuau cgau   aac c
   caaagaua          cc   -       -    --a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-22-3p

Accession MIMAT0032194
Sequence

50 - 

cagcugcccggugaaguguaua

 - 71

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).