Stem-loop sequence pmi-mir-2009

AccessionMI0025129 (change log)
DescriptionPatiria miniata miR-2009 stem-loop
Gene family MIPF0001923; mir-2009
Literature search

1 open access papers mention pmi-mir-2009
(1 sentences)

Stem-loop
   -------    gau   c  g         a          cacau 
5'        ucau   ucu ug uuuuugugg acagcucaug     u
          ||||   ||| || ||||||||| ||||||||||      
3'        agua   aga ac agaaacacc uguugaguac     u
   caaaaac    acu   c  a         c          cuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-2009-3p

Accession MIMAT0032183
Sequence

49 - 

ugaguugucccacaaagaacac

 - 70

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).