Stem-loop sequence pmi-mir-184

AccessionMI0025111 (change log)
DescriptionPatiria miniata miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention pmi-mir-184
(1 sentences)

Stem-loop
   gccuagcggccauau       uuuac        -    -   cgc     ugccaug 
5'                uguuucc     uccuuauc guuc ccg   ccagc       u
                  |||||||     |||||||| |||| |||   |||||       u
3'                acaaggg     gggaauag caag ggc   ggucg       u
   -------cacguucc       uauuc        u    a   --a     uaauaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-184-3p

Accession MIMAT0032163
Sequence

70 - 

uggacggagaacugauaagggc

 - 91

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).