Stem-loop sequence pmi-mir-124

AccessionMI0025105 (change log)
DescriptionPatiria miniata miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention pmi-mir-124
(1 sentences)

Stem-loop
   aauauuu    -----     -     a            au        -ua   a 
5'        ugua     uccag uucuu guguucacugcg  ccuugauu   cac c
          ||||     ||||| ||||| ||||||||||||  ||||||||   ||| a
3'        acau     agguc gagaa cguaaguggcgc  ggaauuaa   gug a
   --gcuac    accua     u     c            ac        cgg   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-124-3p

Accession MIMAT0032157
Sequence

64 - 

uaaggcacgcggugaaugccaa

 - 85

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).